AI Agents for Bioinformatics
Automated workflows for sequence analysis, protein structure prediction, and NGS pipelines. LangGraph-powered agents that orchestrate EBI, NCBI, and AlphaFold APIs.
€29/mo Starter • No credit card required • Cancel anytime
const agent = await client.createAgent({ name: 'sequence-analyzer', workflow: 'dna-analysis', config: { databases: ['ena', 'ncbi'], analysis: ['orf', 'gc_content'] } }); // Execute agent with sequence const result = await agent.run({ sequence: 'ATGCGTACGTAGCTAGCTAGCTAGCTAGC', format: 'fasta' }); // Returns: automated analysis console.log(result); // { orf: [...], gc_content: 52.3%, // ena_matches: 12, annotations: [...] }